instability of a mini-chromosome in heterozygous nod/+ oocytes but not in otherwise wild-type oocytes .... and primer Ak-09, GGAATTCACATCCAGGCCTTGGGCGC, con- ..... ratory manual. Cold Spring Harbor Laboratory Press, New York. pp. 18.64- ... Tags: domain localization chromosome identification
Identification of the Chromosome Localization Domain of the ...
instability of a mini-chromosome in heterozygous nod/+ oocytes but not in otherwise wild-type oocytes .... and primer Ak-09, GGAATTCACATCCAGGCCTTGGGCGC, con- ..... ratory manual. Cold Spring Harbor Laboratory Press, New York. pp. 18.64- ... Tags: domainlocalizationchromosomeidentification
Telephone: 800-288-8178. Website: www.magnetekmh.com e-mail: ... including, but not limited to, this manual and software embodied within the product. This manual ..... TR12-Mini, TR12-PDA (10K12 Systems) ....AK09. 438.2 MHz ... Tags: transmitter mltx engineered telemotive
Telephone: 800-288-8178. Website: www.magnetekmh.com e-mail: ... including, but not limited to, this manual and software embodied within the product. This manual ..... TR12-Mini, TR12-PDA (10K12 Systems) ....AK09. 438.2 MHz ... Tags: transmittermltxengineeredtelemotive